EST 435034 is a singleton


Sequence

>435034 (1 EST) Length=353 TTTTATCAACAATACTATCAACAGCCNCTATGCTTCTCAATATGCAGCTCAGTTTTATTCCAGTGNAATCATCTACAAAT GGNGACTCAGCTAATTCTGGGATAACATCGNATTGGCCGGTGGTGGTACGCTTGNNGGTGATGCTACAGTTCAACAGCAT GCATTCGTCGATGCTGCTGCCTCACATTTATATGCTAGAGCACTCCAGCAAGGCACCGGTTCACAAGAATATGCCCCAGA ACCACATGTATTATCATCAGCTTGTGATCGTCCACGACATGTAGGATGATNTAGATGAAGTATTCANTTCTTTTGGGAAT CATCACGNATGNGCATGTTTACTGATCCATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 435034: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350341154058N33659SMNHADA009019SKSmAW


Date: 14:35:48 on Sun 19 Nov 117.