EST 435043 is a singleton


Sequence

>435043 (1 EST) Length=310 TATCTGNCCAATATGTGGATGNAAAGNAGACAAAACTTGTTCAAAGTGTAAAACCACTTCTTATTGTTCTAAAATGCACC AGGTTCTAGACTGGAAACGACACAAGTTAGAATGTGGTTCAAAGTGTCAAGATGTCATGTTATTATTCGAAGGAAAATAG TTTCTTACTTCCTGGAATACCGTTTATGTTCTGAACCTGCAGACAACTTTTCGAATGATGAAAGCACTTCGGAAGAGGTA GAAAGTGACACTGAAACTGTAGACCTGGGACTTCCANATGATCCTGANGTTGAAGCGCTTGAATCTATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 435043: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350431154067N33668SMNHADA009082SKSmAW


Date: 15:8:30 on Fri 24 Nov 117.