EST 435054 is a singleton


Sequence

>435054 (1 EST) Length=509 GTTAGCTCTGAAGTTCGNGAAAAGAAGCAGTAACAATGGCTACCTTTTTCTCAAGTTTACTTGNTAACCTATCGCTCAAG ATCGTTTTTCAATCTGTTTACTAGATTTGGACTTGCTTTGTCTTTTGTTCCATGCGTACTTCTTCCTACTGGCGTAGCAC ATCACTGTTTTACCCGTTTCGTTTTTAATCCGATTCTTGTTGGACCCTCTAATTCAATGTTGTATCCTGATTGCAGTATT TGCTTACAAATACGTGAAGCTCTAATAATGAATACGTGTGGATTGGTCCTACCCTTAGGCTTNGGCTTTCTTTCTTCCGC AGCCTCTGCACTTATGACACGATCTTACCCTGGTACCTGATCTGCTTGGATGCCAAACGTATTGTGGAGAATGTTCAAGC TCTATAGGTACCTCGGTTTCGGAACCGNTGGGNANTTTGGGGGTTTTGGGNTCAAGACAATATTTGGGAACAANAATGGG CATTTTGCTATGAACCGACAAGAAATCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 435054: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350541154078N33679SMNHADA017056SKSmAW


Date: 4:34:20 on Wed 22 Nov 117.