EST 435079 is a singleton


Sequence

>435079 (1 EST) Length=387 TTCGTAGTTGGTACGNAACCAGGNGAAAACATACGNACAGTAAATTTTCGAGTTTGTCTTCGGNAATTGAAGAATGTCGA GCTGAATGTGTTGGAATTTATTTATGCAATTTACCACTTGTCTTGGAACAGTTTAATCTTAATACTAATTGCTCACCAGA CAGTGTTCCAGATGTTGTTTACGTTAATTGGTTGTCCATGGTTCGCTCGGGTGTGACTTCTATGGAGTTCTATNCACCTT TCAGAAAACGCCAGTGATATTGGTTCGTGGCGNTCAAGCACATTGCTGTGCTCGTTATGCAATTTTGNGGGTTCTAATTG AAGCTGACAATTCGCTGGTACGTATAGACGAAATAGCTGGGTGATGATGGTGCACCTGATTTAACTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 435079: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350791154103N33704SMNHADA019091SKSmAW


Date: 16:22:6 on Sun 19 Nov 117.