EST 435080 is a singleton


Sequence

>435080 (1 EST) Length=494 ATATNGATTGATCAACTTCGTATACTATGNAAATCTCATAAGCCGGATAAACTTGNAAATCCTAAGATTCTGACTTCGAT TACGTAAACTGTGATGGGCGTGGAACTCTGAGNAATCGCTTAACTAGGACAAAACAACTGTCATGTACCTCTTGGGTTTT GTTATATCCCGAAGAGAATTATGAATGGTAACTTTNGAGAACTATTTGTGGACTAATATAATACATATAATTTNNATTGT ATAATTGTTAAGCAACTAAACTGTTCATATTCGTGTTCCTCTTATTATAAGATTTATTTGGACCTATGAACTATTATTAT ACGGNTTAACATTCTGGAGTTATGTCCAGNTTATCAAATTACTANCTCCCACATTCACAAACCACAATTGGGGTAAAGCT TGTACAAATGTGGTTTCCTGTTTTATGGNACGATGTGTTCTGTTNGGGTGGGTATNTTAAACCCAGGATTGTTGGAAATA ATGATNCATTTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 435080: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350801154104N33705SMNHADA020018SKSmAW


Date: 23:15:44 on Fri 17 Nov 117.