EST 435083 is a singleton


Sequence

>435083 (1 EST) Length=502 ACAAGGATGTAANGNGTACANTCCATNTAGGTGAATCAANATNAGAACAANAGAATTGTTATACATCTGTTTNANAAGCC CATATTGCACTTGNTATGNAANTTTCTCCATCGAATACTCCGGGTTCACGACTTGATGTTATATCTCGTCGAATAATGTG GCAATTTCATGGCTAATTATGCTCATGGAACAGGACATGGTGTNGGTGCATTNCTTAATGTACATGAAGGTCCTATNGGG TTATCTGGTAGTCGNATTAACGCATACACTCGTATGGGTATAGTAGAACCAGGCTTACANGAGGAATATGGCTGNTACCA TTGAACCTGGTTNACTATTGGAGTGATCACTTTGGGNATACGATTAGGANAATGTAGNATTTGGTNGGCACCTGNGGAAA CAAAAANTTNCCTTCAATAGTGGACAGGTANNAGCTGGTCCTACATCAACTTCCNACTAGTCACCGANCTTTCCAATNTT CCACCAGACACTGATTATCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 435083: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350831154107N33708SMNHADA020035SKSmAW


Date: 23:2:22 on Fri 24 Nov 117.