EST 435088 is a singleton


Sequence

>435088 (1 EST) Length=103 GCCGATACTTCAGATCAGACAAAGACTCNTTAGGAGATAATGACAATATTACATTCCTCAAATGTTTCTATATAGATACA AGGATAAAGTTACCTTGCTCGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 435088: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350881154112N33713SMNHADA007053SKSmAW


Date: 4:25:54 on Wed 22 Nov 117.