EST 435089 is a singleton


Sequence

>435089 (1 EST) Length=259 TTGTTCTCTTCCACATTAGGGAATTCAGGAGATGAAANTCCTTTATATCCAACGCCAAGATGCCCAACATGTGGAGNAAA TTGCCTCGAAGCGATGTTCGAGATGTCGTCAGGTAATGGTACTGTGGTCGAGGAATGTCAAGTAAAGCACTGGTTAANGC ATAAGGACGCTTGTGACTTGTTANCAGAAGCTATNACTTCTGATAAAAATTCGAATTAACTTTCTTTATTAAAACAATTT TNTAATTCTGATGTAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 435089: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350891154113N33714SMNHADA009028SKSmAW


Date: 7:25:6 on Sun 19 Nov 117.