EST 435091 is a singleton


Sequence

>435091 (1 EST) Length=422 GATAAAGATGGAAATGGGACACTGTCAGAAGAGAATAAGACAATGTATGAAGTTAGTGGATTTATGAAAAATTTCTTACG GAATTTATCGAAACATCGATTTAGATGGAGATGGTGAAATAACTTAGAAGAATATGAAAAAGTACTAAATATGTCCGAAG AGAAAGGAGGAGCTGCTGGGTGTGTATTACTACATGATAAGATATCTGGAAATCCTGTTCTGAGTGTAGTTATGGTGAAT GGTATATTCAACACTGACTCATGATGNTGATGGATAAATACAAGTGGGATGATACACAGTTTAATTCAGCGCGNATAATT CTTGTAAAGNTTNNAGGGGGATATATTCANCACGCAGATGGNGCGTGATCACCACGCAACATCTAGGAATCTATANTTTT GTATGGGTACCNNGGNTGGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 435091: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4350911154115N33716SMNHADA002022SKSmAW


Date: 21:6:15 on Sun 19 Nov 117.