EST 438495 is a singleton


Sequence

>438495 (1 EST) Length=214 ATTTNAATCAATTTTATATGACACATGTTTTACTAGCTTCTTTCCTGACATTTTATCCAAGCAATATGTTTGTTCCGAAA CAAAATCAGCTAATGNGGTAAATTTTCTAGTATAATAAAGAATCGCATATTAAAAAAAAAAAAAANTTAAAAAAAAAAAA AAAANNNGGGGGGGGGGGGGCCCCCCCCCCCCCCCNCCTTTTGGGGTTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 438495: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4384951158244N37102SW3ICA615SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 4:45:18 on Sat 25 Nov 117.