EST 438518 is a singleton


Sequence

>438518 (1 EST) Length=415 ATGCGCAAAATTTCAGTAGTTCCGCTGCTCATCTCGTCTACCTTCCTGGCCTTGCACTACCGTCTTCTCCTCTCCCCACT CAAAACACGTCTGCTGGTATCTNATGTATCTTNAACTTATTCAGCTCCNAGGGAANGAACAGACTCCCCCCTACCTTTTG GGGGGGNTGANATTGCTCGNCAGCACAACAGAATTCGGTGAAGTTAGGGGGGGGGGAGCAAGNACAGGACTGANGAGCAG AAATGGAAGTGATGTCGAAAACATACTGTGAGAGGTGGTCTCATCGCACCTTCATCTNAATTCACTATCGGGTGCGAAGG AAGATCGANTTCAGCTAAAACAACAGCCNCGCCGCGACGACACATCGNCTCAGGCGGGTTGATATAGTAAAATCAGAGAG CATGATGTNANNTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 438518: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4385181158267N37125SWMFCA246SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 20:48:37 on Sun 19 Nov 117.