EST 438519 is a singleton


Sequence

>438519 (1 EST) Length=459 CTCGAGGTGCTGCGATGAAATGTGCTATTCTTNCACCAGCATTTAAAGTTCGAGACTTTTCGGTGAAAGACAGTCAACCA TACAGAATCAAACTTTCGTGGGCACGAATTGGACAAAGTGAGGGAGGCGAGAATGATGTATTTATTGAGCATGATGAATT TCCTTATTCCAAAATGCTTACACTCTATCGACAGGAACCATTTCAGGTTGATGCCAGTTATTCATATCCCAATCACGTTC CACATCCAGCACGACATGTAGGCTCATGGGTTATCAAAAGTGTCGCACCCCGACCAAATAATGAAGCAAAAAAAGTGAAA GTGACAGTTCGAATCAATCCTAATGNTATATTTTCGGGTTGCTCTGNGAATACTTCCGACACCGNCGAAACANGTCATCT GATACTCAGATCAANCGCANCTGAAGNAATGGNAACTGATGACGCTAAAGGCAATCAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 438519: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4385191158268N37126SWMFCA247SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 6:9:21 on Sun 19 Nov 117.