EST 440121 is a singleton


Sequence

>440121 (1 EST) Length=274 ATATTGATGATGATCTTNAAATTCTCCTTCTTTATCACGATTCTCGAAGATAAAGTTTCTAAATTTCGGATGATCAAAAC CTACTATTATGTGATTCTAAATTTCATAGTCTCAGGGAATTCCCAGTATGGCTAGGGTCAGTGTTCCAAATCATGTCTAA GGGTCACGATGTATAGAGCGTAAAGCGTTAATCACTGAGCAGTCACGAGTATTCGATAGTTGCGTCAATGTCATCTAGAT CGTGTGTATAGAGTCTAAGCTCTACGTGATAGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 440121: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4401211150884U43146BMU43146JHU93SL-BmL4 (JHU)


Date: 23:49:12 on Sat 18 Nov 117.