EST 44025 is a singleton


Sequence

>44025 (1 EST) Length=308 ATGAAGCACAAAATGAAGATGATCAAATCAATGATGATCTAAACGGGGACGTTAACGAAGAATTAAATGATGATGTAGAT GGAATGACAGAACATATAGAAGTTCAAGACGAGGAAGATAATGAAAGGGATGTACATGATCCAGAACAAAATGCTGATGA AAATCAGGAAGATGTAGATCAACAACAAGACTCCAATGAAAATNAGGAGGCCGAAGATCAAGAAGAAAATGATAATGATG NTTAAGATTAANNTTATTTACAAAATAAAATTTTTATATATAATTATAATTTTCATTTNATAATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44025: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44025462772T179860300c3cbsPfHB3.1, Debopam Chakrabarti


Date: 7:21:47 on Mon 20 Nov 117.