EST 44030 is a singleton


Sequence

>44030 (1 EST) Length=292 AAAAGATATTTGTTTTGATTCCTTTTCATTATTATATTGTATGTATAAAAATATTATTCAAAATATTTTAAGNATATCAT TTAATTTTACTTATTTTTTTAGTGCAGAATTCTTTTTTTTTAATGATAACATGAATTTAAACTCTTTAGTAAATATAAAA AACCAATTACTTCCAAGTTGTTTATTATTCGATAGTATACGTGCCTTAACCAATATGAAATCACACTATGCATATTATAC ACATATAATGNGACCTNAGGNAAAAACTCCGTAAAAAAGTTAGGAANTGGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44030: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44030462777T179910310c3cbsPfHB3.1, Debopam Chakrabarti


Date: 17:47:52 on Tue 21 Nov 117.