EST 44031 is a singleton


Sequence

>44031 (1 EST) Length=350 TTTCATGTTTCTATCCAAAAGAATTTGAATTAATAAAATCCAGAATGATACATCCAAATATAGTAGATCGTATATTAAAG GGTATAGATAACTTAATGAAAAGTACAAGATATGATAAAATGCGTACAATGTATTTGGATTTCGAAAGTTCCGATATTTT CTCCAGAGAAAAAGTTTTCACCGCCTTATACAACTTCGATAGCTTCATTAAGNCCAATGAACANTTAAAGNAGAAGGACT TAGAAGGAATATCCAGNAATTNCTGTACAATTAGGAACCATCCTNNTGATGGTATTGGGTACAGGAAACAAGGCGNTCTT TATGGAANCTTGGTAAACCCCCAAACCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44031: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44031462778T179920311c3cbsPfHB3.1, Debopam Chakrabarti


Date: 12:47:40 on Sun 19 Nov 117.