EST 44042 is a singleton


Sequence

>44042 (1 EST) Length=282 GTTTATTTCAAAAGGAAAAAATGGTATTAAATGAAGGAACAAGTGGAACAGCTGTTACAACTAGTACACCTGGTTCAAAG GGTTCAGTTGCTTCAGGTGGTTCAGGTGGCTCAGTTGCTTCAGGTGGCTCAGTTGCTTCAGGTGGTTCAGGTAATTCAAG ACGTACAAATCCTTCAGNTAATTCAAGTGATTCAGATGCTAAATCTTACGCTGATTTAAAACACAGAGTACGNAATTACT TTGTTAACTATCAAAGANCTCANAATATCCTCAACTCTTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44042: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44042462789T180030325c3cbsPfHB3.1, Debopam Chakrabarti


Date: 10:32:10 on Mon 20 Nov 117.