EST 44048 is a singleton


Sequence

>44048 (1 EST) Length=232 TTAAAACACCAACAAATAATATAAGATCTTTAATAAAAAGAATTTATACTATACACCAAGCACAATATGTATTAGNTTTT GTTTCTTTAAATTCAANTATTTCTTTTCATACAGATGATAAATCAGCTGTGAATTTTTCAGTCAGTTTTAAAAATGGATC AGAATACTCAAAAGTTGATTATGGAAATCATGATGNACAATTAACTTATACTACTAACCAATTTACAAATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44048: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44048462795T180090334c3cbsPfHB3.1, Debopam Chakrabarti


Date: 14:43:8 on Sun 19 Nov 117.