EST 44053 is a singleton


Sequence

>44053 (1 EST) Length=190 TGAAAATATGAAAAAAGAATGCGTCCCAAATGGATGTATGAAAAAACAATGCGTCCCAAAAGAATGTATGAAAAAAGNAT GCGTCACAAATGGGCATATGNAAAAACAATTGTGTCCCAAACGANTGTATGAAAAAACAATGCGTCCCAAAAGATTGTAT GAAAAAAGAATGCGTCCCAAATGGATGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44053: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44053462800T180140340c3cbsPfHB3.1, Debopam Chakrabarti


Date: 13:49:36 on Mon 20 Nov 117.