EST 44065 is a singleton


Sequence

>44065 (1 EST) Length=300 ATCAGGTGAACCATTAATAGATGTACACGATTTAATATCTGATATGATCAAAAAAGAAGAAGAACTTGTTGAAGTTAACA AAAGNAAATCCAAATATAAACTTGCCACTTCAGTACTTGCAGGTTTATTAGGTGTAGTATCCACCGTATTATTAGGAGGT GTTGGTTTAGTATTATACAATACTGAAAAAGGAAGACACCCATTCAAAATAGGATCAAGCGACCCAGCTGATAATGCTAA CCCAGATGCTGATTCTGAATCCAATGGAGNACCAAATGCAGGCCCACAAGTTACAGCTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44065: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44065462812T180260380c3cbsPfHB3.1, Debopam Chakrabarti


Date: 10:11:18 on Wed 22 Nov 117.