EST 44067 is a singleton


Sequence

>44067 (1 EST) Length=305 AAAGAAACAACAAAATTACGGCAACGTCATCAATAATAATAATAATAATAATAATGATCATGTTAATAAAGAAAATAATT CCCCTTATATACACCAAACCAATAATGCTCATCAAAAAAATCTTCCTGCTATACACAATTTTGACAAAATAATATCAACA GATTTTGTTGATGAACAAGGTAATATTTTTAATGATAAATGGAGATTTAATTATTACCTTTAAATTTTCTTTTAATCAAG TAGATTATGAATTAGCATACCATCATTATAAAAGTATAATTTCATATTNTCCAAGCAAATTTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44067: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44067462814T180280382c3cbsPfHB3.1, Debopam Chakrabarti


Date: 15:58:29 on Tue 21 Nov 117.