EST 44068 is a singleton


Sequence

>44068 (1 EST) Length=276 ATTTCTTCAAGANATAAAGGAAAGGGATAGATTGAATAAAATATCGAGTGCTAAATATAAAAAACAAATAAGAATGAAGA AAAAAGGTTTAAGTTTTAATTACAACGATTAGATATTTGATTCATATGTACCTATGGGTCATAGCCATAAATGGTATATG ACATTATTATATAAAANTATTATTTATGAAATTGATTCAGCTCGACAACACAAGAGTAAATAAATAAATAAATAAATAAA TANACTATATATATTATATNTNTCTATATCTCCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44068: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44068462815T180290384c3cbsPfHB3.1, Debopam Chakrabarti


Date: 18:2:25 on Tue 21 Nov 117.