EST 44070 is a singleton


Sequence

>44070 (1 EST) Length=275 ACGATTACATAAAGCTTCCTTTGAAGAAATATCTCACGTGAGGGACAACATCAACATGGTAGATAACACAAACGATGGTC ATATTATAAACAATGATAATATTACAAACAATGATGATATTACAAACAATAATAATATTACAAACAATAATAATATTACA AACAATAATAATATTACAAACAATTATAATATTACAAACAATAATAATATTACAAACAATAATAATATTACAAACANTCA ACATATTNAATGATGCTCTTTGTAANATAATAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 44070: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44070462817T180310386c3cbsPfHB3.1, Debopam Chakrabarti


Date: 11:46:8 on Wed 22 Nov 117.