EST 44071 is a singleton


Sequence

>44071 (1 EST) Length=266 AAAAAAAATGAAAAAGTTAAATGATGATATAAAATATAATATTATCATTTTATCATTACATGTCCCAAAATTTAATTATG AATATGATCTTTTTAATTATTCAGAAAATGTCGTATTCATAAGAGGTTCCCCTTTAAATAGTTATAATTTAATACAAGCT GGTGTTTTTTATGCAAAGAGAATTATTATATTAAATTCAAACCATAGTTTATTTATTGATAAAGATGCATATAGCATAGA TAACGNAGTAATAATTATTAAAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 44071: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44071462818T180320387c3cbsPfHB3.1, Debopam Chakrabarti


Date: 19:21:17 on Fri 24 Nov 117.