EST 44079 is a singleton


Sequence

>44079 (1 EST) Length=262 GTCTCCAGTTTTTTTTTTTTTTTTTCCTTTTGTTGCCACTTCATAGTTGGATTTAATAGTGGACATGTTGTAACAAAGAG AAATTTAAAATTACATAAGAAAAAGAAACCATTTTCTAAAAGAAAAGAATTGATAAAAGATGTCGTTAGAGAAATTACTG GATTTAGTCCATATGAAAAAAGAATAATTGAATTGATAAAAATAGGTACATCTGCTTCTACTAAAAGAAGTTTAAAATAC GCTAAAAAAAAGTTAGGAACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 44079: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44079462826T180400396c3cbsPfHB3.1, Debopam Chakrabarti


Date: 4:50:40 on Sat 25 Nov 117.