EST 44080 is a singleton


Sequence

>44080 (1 EST) Length=262 TAGATTTCAAAATATTTAATTATCTAAATAAATTTAATTAAAAATTTTTATAACATATTTTATTTAAGATTTTATAATAA TTAAGTTTTAATTTCTTTTGATCCAAAGTTTTTAATAATTAAATTTGTAGATTTTTAATTTATTTAATATATTCAAAATG AAAATCTTATCAGTATTTTTNCTTGCTCTTTTCTTTATCATTTTCAATAAAGAATCCTTAGCCGAAAAAACAAACAAAGG AACTGGAAGTGGTGTTAGCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44080: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44080462827T180410399c3cbsPfHB3.1, Debopam Chakrabarti


Date: 4:26:7 on Thu 23 Nov 117.