EST 44085 is a singleton


Sequence

>44085 (1 EST) Length=243 GGCACGAGTTTTTTTTTTTTTTTTTCGTCGGCTATAAAATATATAGGTTTAATTAAGGAAACGTTAAGTTAATATAAAAA AAGGAATATAAAACAACGGGTGTACAAAAAAATAAATAATAAAAAAAATATATATAAAATTAAAAAATGTAATATATAAT ATATGATAAATAACATACAAAAGGTATACCCTTTTAATTTATTATTATTATTATTATTATTGTNATTATNTNTATATATT TNN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44085: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44085462832T180460409c3cbsPfHB3.1, Debopam Chakrabarti


Date: 20:42:53 on Tue 21 Nov 117.