EST 44088 is a singleton


Sequence

>44088 (1 EST) Length=238 CGGCACGAGGAAAATGTATATTTAAGTTTACAATTGAAGAAAATAAAATATAAGCAGCGTTTTTATTTATCATATAGTGA CATAAAAAATAATGTGGATGATGATGGTGTGTATATATATAGAACACAAAGATATGTATCGNAGAAAAAAAAATACACTA TAAAAAATGAAGANCATANTAAAATATANTATAATATAATAAAAANCACAGCATGGTTACCATTAATTGATGTGTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 44088: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44088462835T180490413c3cbsPfHB3.1, Debopam Chakrabarti


Date: 0:52:15 on Wed 22 Nov 117.