EST 44091 is a singleton


Sequence

>44091 (1 EST) Length=289 GAACTAGTCTGAGTTNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCATAAAAAAAAATACACCATTTAATTTGATCAG TCTAATAGAACTCATACAGTTTTTATATTTGCTTGAATATCATAAATAAATAATAAAAAGAAGTATATTTTTCAAGACAT GAAATATTAAGAAAATAGTGTGGATATAAAAATAAATGTGTATACATATAAGNTAAGGAAAAATATTGTATAAAAGGTAG CATACTTTATCATATACACAAAAATGTGAATGNCCCAAAAGTTAACCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44091: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44091462838T180520416c3cbsPfHB3.1, Debopam Chakrabarti


Date: 0:9:33 on Sun 19 Nov 117.