EST 44099 is a singleton


Sequence

>44099 (1 EST) Length=277 GCACATTTAAAAACACGTTTTTGTCCGAAAGAAAATAATGATAAACTATTTATTATTAACAAAAATTTTCAAAAGCCCTT TGAAGAGTATTATTTGAATATTTCCNTACANGTATTCATAACAGGATTGAACGTGTTAACAAATATTACTAAATTAATAA TCTTAAAATATGATATAGATTATAAAANTAATATAATANTTAANGGTTCAAATATTCTGAACAAACAAAAAANAANCAAA AAAAAANGGGGTAGCATTATCACGGTTTATTATAGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44099: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44099462846T180600438c3cbsPfHB3.1, Debopam Chakrabarti


Date: 11:36:3 on Fri 24 Nov 117.