EST 44100 is a singleton


Sequence

>44100 (1 EST) Length=277 GGTTTTTTTCAAATAAGGGAACCGTAAAGAATGCATTTAAGAAAAGCAATTTAGGATATGAAGTAATGTTAGATAGAAAA GAAGATGAGAATTTTATTTATTCAAATTATGAACATGTGGAAACACAAGTAGAAAAGGATTCTAAAGGTATGGTCGTATG TAAAANATATAAGANTACTTATGAGATATTAGTTGAAAAGGTAAAAGNAAAANGATTAGGAGTTTTATTAGTTGGGATAG GTGGTAATAATNCTACGACTATGTTAGGAGGTATTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44100: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44100462847T180610439c3cbsPfHB3.1, Debopam Chakrabarti


Date: 4:56:57 on Tue 21 Nov 117.