EST 44101 is a singleton


Sequence

>44101 (1 EST) Length=276 AACTAGTCTCGAGTTTTTTTTTTTTTTTTCNCTTCCTTTTTTGTGTTTTGATGATCTGCTTAAATATTTTCAAGGTGTTT GATATGTACTACTTTTTATAAAATTAAAGNAAAGAGAGAGAGAGAAAAAAAGAAAGGAAAAAGAAAGAAAAATACAAAGT AAATAATTTATAAATAATAAATATTCCTGTCCTAACATATTATAATAAAGTAAAACATTATGGTATATATAANTAAATAG GGCACATCGAAGNGAAAGAGGTAGGGGCATATAANT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 44101: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44101462848T180620440c3cbsPfHB3.1, Debopam Chakrabarti


Date: 5:57:47 on Thu 23 Nov 117.