EST 44102 is a singleton


Sequence

>44102 (1 EST) Length=277 GAATGGAAAAAAAATTAATAATATTGAAGGAGAACAAAAAGATGATATTAATAATTCCCAAACGCATAATTATAAAAATA AAGATGTATCAAATAAAATTATAATTTCATCACAAAATAGTTTTTTACCAAATGTAGAAAAGAATAATATTTTTGTTGAG TATGAAACTCACTGGGATAATGATAAAATAAAAGAAATGTTAGAACTTCAAAAGGNTACAAAGATATTGAAAAATTATTT ATTTAAAGGGGTACTATATATTTCACCCTTTGNTACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44102: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44102462849T180630441c3cbsPfHB3.1, Debopam Chakrabarti


Date: 15:3:13 on Sun 19 Nov 117.