EST 44106 is a singleton


Sequence

>44106 (1 EST) Length=273 GTTGACGCTGTATATGAAGATGATAAAGTCATCGCATTTAATGATATATACCCACAAGCACCAGTACATATTATAGTCAT ACCAAAAAGGAGAGATGGTCTTACTAGNCTAAGCAAGGCAGAAGAAAAACATAAAGAAATTTTAGGACATTTAATGTGGG CTGTTGCTGAAATTGTAAGAAAAAACAACCTAGGAGATTTCCGATTGGTAGTTAACAATGGACCTGAGGCATGTCAATCC ATATACTATTTACATTTACATATATTAGCCAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44106: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44106462853T180670446c3cbsPfHB3.1, Debopam Chakrabarti


Date: 5:15:33 on Sat 18 Nov 117.