EST 44112 is a singleton


Sequence

>44112 (1 EST) Length=276 TAGAATTGAAGCAAGAAACAACCTAGAAAATTACTGCTATAATGTTAAAAACACATTACAAGATGAAAATTTGAAAACAA AAATACCAAAAGATGATTCAGAAAAATGTATGAAAACAGTTAAATCTGTTCTTGATTGGTTAGAAAAAAATCAAACAGCA GAAACTGAAGAATATAATGAAAAAGAAAAAGATATTTCATCAGTATATAATCCTATAATGACTAAAATATATCAAGGTGC ATCAGCACAAGAACCACAAAAAGCAGAGGCAACCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44112: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44112462859T180730455c3cbsPfHB3.1, Debopam Chakrabarti


Date: 23:26:51 on Sun 19 Nov 117.