EST 441121 is a singleton


Sequence

>441121 (1 EST) Length=389 GAATTCGGAACGAGATAAACATTACTTTCTCGTTGGTTGGTGTTGTTNGGATTATGTAGCATTCTCTAACCTCTCCATGT AACAGTATGTGGTTATCTGCTAACTAGATATTGNTTTGGNTTCAGCATCCAGNATAATGCCTGTTTTNTTCGGNCCCCTT GGTCACTCTTTATTAATGATTGAAGAGTCGGNTCATTGCTATNCGCTGAACTGTNCTGCTCCCATATGTCCTTACAGGTG GTTTGNCACTCAGCCACTAGTTTTAGAACATAAGCCAAGCACAGGATGTTCGCNTACGTTTAGAGGAAGACGCCNTTTCC TCAGTTGGANGATGAATACAGTNCTTCTGTTCAGACAGATGANAAGTGTCCCAAGTGTAGTCATACGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 441121: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4411211162891N21729SMNHADA016007T3SmAW


Date: 3:46:55 on Sat 18 Nov 117.