EST 441128 is a singleton


Sequence

>441128 (1 EST) Length=200 ATATATGTTCGACACATCTAATGGGGTTGTGAAGTAGGTAAATNGAATCATCTGGAGAGATGAGTAATCCATTTAGCAAA TGTNNGGTCATAGTANGGTTTGTATGNNTTANGATTCCAACATTCATGCTGGGTAGGGGNGGTNTNANTTCAACCTGAGT AAATCACTTNGATAGCCACATNTNTATGTTCTCTTCACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 441128: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4411281162898N21692SMNHADA009022SKSmAW


Date: 9:54:42 on Fri 24 Nov 117.