EST 441129 is a singleton


Sequence

>441129 (1 EST) Length=262 GAATNCGGCACGAGATTCGGTCGAGAGACATTGGAAAAGATACGACATAACTAAGGATTGGGAAAACACTGCATGGGCAC GAAAGCTTCATCGCAAATCCTTGCGTGCGGTTATGACCGACTTCGACAGGTTTAAAGTCATGGTAGCTCGTAAACAGCGC AACAACATCTTGAAACAGTTCAAGTTGAAGAAGCCCATTGAAAAAACCACGAAGCCTGTAATGAAGGCAGTAAAAAAGTA AATTAATAAATGCCTCATCTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 441129: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4411291162899H98305SMNHADA016061T3SmAW


Date: 2:46:26 on Thu 23 Nov 117.