EST 441135 is a singleton


Sequence

>441135 (1 EST) Length=574 ATAGATTAATAAATAGATTTGGATGTACACAAGTANCAGCAGGCAAGTAGTGTGATTGATCCAGCAANCAGGGTTACATC TCACGNAACGAATGGGAAGCGGGTTGTCTGCCGGGTCTATATATTTATTTACTCATATAGTATTGAGAGAGGGTGTGAAT ATNTTCGNTAGATCTATTGGANGTATTTTATCTGGGATGTATTACATTCGGTCCTCGTGAATCATGTNTACAGGTAGGAA GCGANGACTTCTTTTGTTGATGACATGCAGATAGATCAGATGACTGCGGTGAGGGNCATCAAGTACAACATGGNCTCCGC ATGTCATAACACCAGCTGTTTTGTATCGTGCTTTGCGTTATCNNTGCTGNGGCTGGNACAAACATCTCTCCGACTTCTGC TGGCGGCNGTTATGGTGGTGGTGTCAGANATTAAGCCACGCATCTCTACGAGCAAGCCTTTCTATCCAGNGACCCGCCNG CGGCTCAAAATACAGCTATTNCTCTCTTGGGCNTGCCCCTCCCGTCCCTTACCCCCTCCNCTTTGNGNTAATCAANCAAC CCANCCCCNCCCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 441135: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4411351162905N39685SWMFCA251SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 7:28:32 on Sun 19 Nov 117.