EST 44116 is a singleton


Sequence

>44116 (1 EST) Length=251 CTAGTCTCGTGCTTTTTTTTTTNCTTTTTCCTTTTTTTGTTAATAATAATGGTAAAATATAATAGAAAATAAAAATAGTG ACAGGTGTATTAATAAGNTGATTATAATACNTAGNGNTAATTTTACTTCAAAACTATAAAAAGAAGAAAAAAAAAAGGAA AAAAATGAAAAATGATGTAAAANAGGATGTAAAGGATGATGTAAGANATGATGTAAAGGATGATGTAAGANNTGATGTAA AGGGTGATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44116: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44116462863T180770460c3cbsPfHB3.1, Debopam Chakrabarti


Date: 15:34:46 on Fri 24 Nov 117.