EST 44117 is a singleton


Sequence

>44117 (1 EST) Length=148 CCATGTCATTTTATATAATTCTTAATATGTATGTGTTTGTTTTTAAGCTTATTCATGTTTTATGAAAATATGAAAAAGNT ATACTTACACCTATAAATATTGATTATGATATAAAATATTATATAAGANTTGTNATATATATATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44117: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44117462864T180780462c3cbsPfHB3.1, Debopam Chakrabarti


Date: 21:49:49 on Sat 18 Nov 117.