EST 44119 is a singleton


Sequence

>44119 (1 EST) Length=212 CAACACCTAACACATCATATACATCAATATTTTGATCAATACATTTTTTTATTAAATTACTTCCTTTTTTAAATTGACCT TTTATATTATCAGCACCATTATTATTATTTTCTTTATTATCATAATCATCTTTATTCATTTCCTCATCTTTTTCATTAGC TTTTNTTCTTTTGTNTTCTTTATCATTACTAATGTNTTTATCATATATATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44119: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44119462866T180800467c3cbsPfHB3.1, Debopam Chakrabarti


Date: 11:47:11 on Wed 22 Nov 117.