EST 44125 is a singleton


Sequence

>44125 (1 EST) Length=255 GAAAGTCAAGCTGTTATATAGAAATCGAGTCAGATAGTTGCTTAGAACTGTTAGGTGGGAATTATAGTATGAATGAAAAA AGTATACTTATAAAAAAAGAAATTTTCAAAAACCTAACAAATGATAACAATGAAGGTTTTACCTTTGAAATGTGGATAGG AATAAATGAGTCCTTTTTTGATAGAAAAGGAGAAAAACAAAAAAAGANAAAANGTAANAAAAAAAANATACATGTACAAT CGAGTGANGATGTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44125: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44125462872T180860480c3cbsPfHB3.1, Debopam Chakrabarti


Date: 19:54:5 on Fri 17 Nov 117.