EST 44135 is a singleton


Sequence

>44135 (1 EST) Length=341 TACATTAACCGTTCAGGTGATTACATTTGAACAAATCTTAAATATGCCTTTTGGGATGGTACATCAATTTTTTTACTTCA TTTTTAAAAAGTTTTGGCAGGTNTGCATTATCAACAGATGGTAAGATACAGCATTTGTCTCCTTCTTTCCAATTAACAGG NGTAGCAACAGGGTGTGTGTTTGTAAGTTGTAAGGATTTAAGAACTCTAAGAATTTCTTGAGAATTTCTTCCTGTTGTGG CTGGATAAAGAACGGTTGCTTTGACTTTTTTATCTGGNGAAATAAAGGAAACACATCTACAAGTTAATGGAAGGCCTTTA ATACCTTTTCCTTTTCATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44135: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44135462882T180960496c3cbsPfHB3.1, Debopam Chakrabarti


Date: 2:18:58 on Mon 20 Nov 117.