EST 44136 is a singleton


Sequence

>44136 (1 EST) Length=158 GGCACGAGATTTTATTAATAATTCCACAATTATAATATAAAGTCTGATTCTTTTATTATTTNATTTATTTTTTTTTTTCG TTTTTAAAAAAGACGTAAATTACATCTATTGAGATTATTTATCAAATAATTTAACATAGATGATAATTACATATATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44136: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44136462883T180970497c3cbsPfHB3.1, Debopam Chakrabarti


Date: 2:52:43 on Mon 20 Nov 117.