EST 44143 is a singleton


Sequence

>44143 (1 EST) Length=242 GAGTTTTTTTTTTTTTTTTTTCTAATTGTAATTTATCTTTAACATTATTTGTATAATATGCACTCAGTCTAGTATATTTC GGAATTTCGATATTACATGGNATATTTATATTCTTTCCAAGAACACAACATTCATCAATAAATACGTTCTCATTTATAAT TACATTTNCATAAATAAATGANCTTAATATACTAACATTATCCTTAATAATACAATTATNNGCTATTACGGTATTTATAA TT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44143: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44143462890T181040623c3czapPFDd2.1, Debopam Chakrabarti


Date: 17:55:13 on Fri 17 Nov 117.