EST 44146 is a singleton


Sequence

>44146 (1 EST) Length=204 AGGTGTTAACTAATAAGAAAAATAAAATGAAATATGAAGATTTTAATTTCATTCGTACACTTGGAACGGGTTCCTTTGGT AGAGTTATTCTCGCTACCTATAAAAACGGGAACTACCCACCAGTAGCCATTAAACGTTTTGAAAAGTGTAAAATTATAAG NCAAAAACAAGTGGATCATGTTTTTNCAGAGAGNNNAATATTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44146: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44146462893T181070648c3czapPFDd2.1, Debopam Chakrabarti


Date: 21:21:54 on Sun 19 Nov 117.