EST 44152 is a singleton


Sequence

>44152 (1 EST) Length=151 CCAAACATATATAAATATGAAGAATATAAAGATTTAAAAATACTTAAAGAAAAAAACAAAAAAGGAAACATCGATAAAAT CATAGATGAACATACTATTATATGTAAAANGTTATTTCAATCATCTAATCAGGTTATTCCATATATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44152: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44152462899T181130661c3czapPFDd2.1, Debopam Chakrabarti


Date: 4:21:41 on Fri 24 Nov 117.