EST 44154 is a singleton


Sequence

>44154 (1 EST) Length=341 AAAAAGAAGAATTTGAATATGATGAAAATATGGAAAAAGCTAAACAAGACAAAAAAAAAGCACTTGAGAAAATAGGAAAA CAATCAGACGAAGAACCTTTTATGTTTTCAGAAAATAAATTTCTTGAAAATCAAGTAAAAGAAAGAAATGTTGCTGGATC CTTTTCTCGATTTTTCAGTAAATTAAATCCTTTTAAGAAAGATGAAGTAATAGAAAAAACTGAAGTATCAAAGNAAACAT TTTCAGGTATAGGTTTTAATCTTACTGACAATGNAGCTAAAGTATTAGGGTGTAGGGTGTAACCTATTCAAGNATATNCC AGAAACCATGTTNATATAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44154: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44154462901T181150663c3czapPFDd2.1, Debopam Chakrabarti


Date: 6:14:27 on Wed 22 Nov 117.