EST 44161 is a singleton


Sequence

>44161 (1 EST) Length=313 AAAAACAAAGATATAATAATAAATTTTCATCCTCTAATAATTCTGTATATAATGTTCAAAAATTAAAAAAGGCTCTTTCA TATCTTGAAGATTATTCTTTAAGAAAAGGAATTTCTGAAAAAGATTTTAATCATTATTATACTTTGAAAACTGGCCTCGA AGCTGATATAAAAAAATTAACAGAAGAAATAAAGAGTAGTGAAAACAAAATTCTAGAAAAAAATTTTAAAGGACTAACAC ATTCAGCAAATGCTTCCTTAGAAGTATCTGATATTGTAAAATTACAAGTACAAAAAGTTTTATTAATTAANAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44161: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44161462908T181220676c3czapPFDd2.1, Debopam Chakrabarti


Date: 11:36:14 on Fri 24 Nov 117.